Sebelum mencedok atau memetik 'ilmu' dari laman ini, anda tidak perlu meminta kebenaran tetapi diingatkan membuat semakan sendiri terlebih dahulu dengan doktor anda atau guru anda sebelum mem'forward'nya kepada orang lain dan memikul tanggungjawab akibatnya.

Pohon doa kesejahteraan dan limpahan rahmat Allah ke atas guru-guru saya dan juga pesakit-pesakit saya yang banyak mengajar saya bidang ini. Segala pujian bagi Allah (peringatan ini untuk diri sendiri) . Mudah-mudahan, taubat saya diterimaNya dan segala dosa saya diampunkanNya serta saya terus dilimpahi rahmatNya. Sekiranya ada kesalahan, pohon dibetulkan, saya terbuka kepada teguran.

Sebarang percubaan berbentuk komen atau soalan bertujuan mengiklankan apa sahaja perniagaan atau blog sendiri tidak akan disiarkan. Blog ini bukanlah untuk iklan menjual barang. Peace.....

Monday, 25 July 2016

World Embryologists Day 25th July

Bis-mil-laa-hir-rah-maa-nir-ra-hiiiiim.
In the name of Allah, Most Compassionate, Most Merciful.



Embriologis-embriologis kesayangan PHKL. 

Hanya yang tengah (Mr Tham) sahaja yang belum berpunya. Cik Chew Fang (di kiri gambar) masih single tapi setakat ini 'unavailable'. Puan Fariza (kanan gambar) pula ibu kepada 2 anak.

.
.
.

25hb Julai adalah Hari Embriologis Sedunia (World Embryologists Day).

Ia mengambil sempena tarikh lahir bayi pertama hasil persenyawaan tabung uji iaitu Louis Brown yang dilahirkan pada tahun 1978.


Embriologis sangat mempengaruhi peluang kejayaan IVF terutamanya ICSI :

- Kesabaran mencari sperma yang bagus untuk digunakan dalam ICSI.

- Teknik suntikan ICSI (boleh dilihat pada rekod 'ICSI fertilization rate' masing-masing embriologis yang sepatutnya melebihi 70%).

- Ketelitian dalam setiap langkah ICSI, penjagaan ovum, sperma mahupun embrio; kesemuanya dilakukan tanpa mengambil 'short-cut' dan sentiasa disemak/disaksikan oleh embriologis kedua.

.... banyak lagi.

.
.
.

Cuma, mereka bekerja di belakang tabir, maka kadang-kala malah mungkin lebih daripada itu i.e. selalu dilupakan.

Apabila ICSI fertilization rate bagus, doktor yang terlupa mengucapkan 'syabas' kepada mereka.

Apabila pesakit hamil, pun ada doktor yang terlupa menghargai mereka.

Apabila pesakit tidak hamil, ada pula doktor yang cepat menyalahkan embriologis tanpa menyedari bahawa mungkin kekurangan ada di pihak empunya diri sendiri ...... atau mungkin tiada kaitan langsung.

Kasihan embriolgis-embriologis ini.

.
.
.

Peringatan untuk diri sendiri.

Kita berada di sini hanya untuk membantu.

Rezeki hamil atau tiada rezeki hamil bukanlah kuasa kita.

Di samping itu, lakukan semakan semula, teliti; jika ada;  apa kesilapan serta kekurangan dan cuba baiki.

Apabila pesakit tidak hamil, janganlah cepat melatah disalahkan embriologis pula tanpa menyemak terlabih dahulu.

Entah-entah rekod kehamilan pesakit-pesakit mereka rupa-rupanya bagus dengan doktor lain.


Kepada Chew Fang, Fariza, Tham dan seluruh embriologis di mana sahaja;

Happy Embryologists Day!


Sekian.

Al-ham-du-lil-lah.
All praise is due to Allah.








Monday, 11 July 2016

Celebrating the MIRACLE BABIES of PHKL - Saturday 30th July 2016

Bis-mil-laa-hir-rah-maa-nir-ra-hiiiim.
in the name of Allah, Most Compassionate, Most Merciful.






Untuk julung-julung kalinya,
PHKL akan mengadakan pertemuan sesama pasangan yang pernah mendapatkan rawatan kesuburan di sini, sama ada :

- yang telah bersalin
- yang sedang hamil
- yang sedang dalam rawatan kehamilan
- yang pernah gagal dan masih ingin meneruskan rawatan kesuburan di PHKL

... sama ada melalui kaedah IVF, IUI atau 'courier/transporter FET'.


Cuma....

Yang tak sempat dijemput adalah yang hamil secara ubat subur sahaja atau hamil selepas menjalani pembedahan membaiki sistem peranakan eg pembedahan Endometriosis dsb kerana kami kesuntukan masa mencari rekod/fail memandangkan mereka tiada dalam rekod Unit IVF. Maka, sesiapa yang namanya tertinggal, sesiapa sahaja yang pernah mendapatkan rawatan kesuburan di PHKL dengan mana-mana doktor PHKL, bolehlah menghubungi :

03-22960892 (Ida)

... dengan memberikan nama penuh dan nombor IC atau nombor pendaftaran PHKL untuk dibuat semakan rekod/fail. Kita gunakan juga kaedah 'menjemput diri sendiri' ya. 


.
.
.

Program ini berlangsung selama setengah hari, bermula pada pukul 9.30am dan dijangka berakhir pada pukul 1 tengahari, insya' Allah.


Antara acara menarik;

1. Best Captured Moments Photo Contest.
Pastikan anda menghantar gambar tersebut menggunakan instagram seperti tertera di atas.


2. Mini Me contest
Lebih kurang ala 'siapa yang paling serupa' ala-ala My-Clone masing-masing, cuma ini lebih pada gaya pakaian. Maklumlah anak-anak kecil masih belum nampak sangat seiras rupa dengan ibu atau ayahnya. 

Ada pemerhati pada hari tersebut untuk 'memilih' pasangan ibu-anak atau ayah-anak atau ibu-ayah-anak sedondon sama ada berbaju Hari Raya ataupun berpakaian stail tersendiri.


3. Embrologist For a Day
Anda boleh menyaksikan bagaimana embriologis kami bekerja. Contohnya anda boleh melihat dengan sendiri menggunakan mikroskop yang disediakan saiz dan rupa sebenar sperma dan telur (cuma kali ini menggunakan sperma dan telur haiwan).

Malah, anda juga boleh mencuba melakukan prosedur 'sperm catching', satu prosedur yang memerlukan kemahiran embriologis dan menentukan kejayaan fertilization telur secara ICSI. Barulah anda faham akan kesukaran mereka melakukan tugasan ini, salah satu sebab mengapa kos IVF mahal. Ini baru 'sperm catching' , belum lagi prosedur lain. Sebenarnya ada banyak lagi faktor lain eg 'sperm selection' dll. 


4. Bento Set Demonstration
Anak memilih atau cerewet untuk makan? Anda boleh gunakan teknik 'menghias' makanan untuk nampak menarik di mata anak anda. Yang melakukan demonstrasi ini bukan calang-calang orang. Siapa lagi kalau bukan Pakar Pemakanan PHKL (Dietician). Sesiapa ang telah pernah mendapatan panduan pemakanan dari dietician PHKL lazimnya berpuashati dengan nasihat pengambilan kalori pemakanan yang diberikan.

Anda juga dapat membawa pulang bekas comel untuk membuat bento telur rebus.
Ini adalah di antara cenderahati yang disediakan pada hari tersebut.


6. Baby Massage Demonstration
Ini pun diajar oleh staf PHKL yang memang terlatih dalam bidang ini. Sesiapa yang pernah melahirkan bayi di PHKL mungkin pernah bertemu beliau.


7. Program-program lain seperti yang tertera di poster di atas dan beberapa pertandingan atau permainan, saya teka mungkin 'pertandingan ayah yang paling cepat memakaikan lampin anaknya'. Mungkin.


8. Program tambahan yang saya tunggu-tunggu (dah bertahun dah ni dirancang dan ditapis berkali-kali) : pelancaran website baru kami "Journey to Conception" IVF Microsite oleh CEO PHKL : En Anwar Anis.


9. "Couple's Sharing Session" secara informal.
Masa inilah nak buat support group baru atau buka WhatsApp TTC Group tambahan. 


10. Makan-makan juga ada disediakan.
Sewaktu pendaftaran 9.30-10am : light refreshment
Akhir program 12 tengahari : lunch



PROGRAM INI MELIBATKAN PIHAK MEDIA.
Ada sesi 'press conference' di antara pihak PHKL dan media.
Bagi mereka yang inginkan 'privacy' maka tidak dapat hadir, jangan bimbang, kami tidak berkecil hati. Kalau nak datang pakai topeng muka dll, kami tetap sambut dengan tangan terbuka. Tetapi bawa kad pengenalan diri ya.


Di tengah-tengah keseronokan tu, jaga anak masing-masing ya. Nak perhatikan anak orang lain pun boleh juga, manalah tahu kot-kot nak cari calon menantu, ahaha.


Tak sabar tak berjumpa setelah lama dilepaskan kepada doktor-doktor perbidanan yang lain.
Kita jumpa di sana! Insya'Allah





Sekian
Al-ham-du-lil-lah.
All praise is due to Allah.

Sunday, 3 July 2016

Ucapan Selamat

Bis-mil-laa-hir-rah-maa-nir-ra-hiiiim.
in the name of Allah, Most Compassionate, Most Merciful.


ATCGGCGCGCATTAGCTAGCGCGCATGC
GCGCTAATATTAATSELAMATGCTAGCTA
CGCGCGGCTAGCHARICGCGTAGCATGC
TAGCCGGCCRAYAGGCATGCATGCATGC
GCTAGCCGCAIDILGCFITRIGTAGCTAAT
TACGMAAFCGATZAHIRTACGBATINATGC
GCTATACGCGGCTACGATCGGCTAGCTA


Ini code gene baru saya tahun ini.
Boleh baca 'secret message' di dalam susunan AT dan CG di atas?

.
.
.


ATCGGCGCGCATTAGCTAGCGCGCATGC
GCBERHATITAHATIATDITAATJALANRAYAGCTCTA
ATCGCGTACGGCTAGCCGATCGTAGCATGC
TAGCMARAHCGGCITUCGATMUDAHGCATGCATGC
GCTAGCCGCGCGTAGCTAATGCTACGAT
TACGSABARATTAITUCGATINDAHGC
GCTATACGCGGCTACGATCGGCTAGCTA



...serta ucapan khas untuk seseorang yang berkampung di hospital ini, bersama-sama janin-janinnya yang di dalam uterus, juga embrio-embrio yang masih dibeku-simpan di hospital ini juga. Ini kali ketiga beliau hamil. Kali pertama, beliau keguguran pada usia kandungan 5 bulan,  kandungan kembar. Kali kedua, pun keguguran pada usia kandungan 16 minggu, singleton. kedua-dua kandunga ndipasang 'cervical cerclage'. Saya lakukan ujian-ujian untuk 'recurrent miscariages' (walaupun baru 2 kali keguguran), kesemuanya normal.

Lama beliau menyepikan diri mencari kekuatan sebelum menjalani FET pada 24.05.2016 baru-baru ini.

Kali ini, beliau memilih untuk 'bermukim' di hospital ini berselang bulan (mengikut jadual suaminya yang bertugas di perantauan berselang sebulan). Beliau ada mengalami pendarahan 2 minggu yang lepas dan saya tambah ubat 'luteal support' beliau. Pendarahannya telah berhenti tetapi kawasan 'darah beku' masih sama ukurannya. Kita doakan semoga kali ini kandungan ketiga (kembar) beliau selamat dilahirkan dan mencecah usia sekurang-kurangnya 34 minggu, aamiiiiin.


Tiada ibu mahupun ayah yang sanggup menghadapi 'anak-anaknya pergi' lebih dahulu daripada mereka. Di sebelah kiri gambar adalah kubur Aisyah dan Amirah manakala di sebelah kanan adalah kubur Aydan Luqman. Semoga pasangan ini diberi kekuatan dan dibalas dengan rahmat berterusan dariNya.


Di wad, rupa-rupanya ramai rakan-rakan TTC datang memberikan sokongan moral (dan juga bekalan makanan, amboi! Bertuahnay badan!).


Ada yang sempat singgah di klinik berjumpa saya. Ini Ammar, baru berjumpa Khamis yang lepas. Dah nak masuk 3 tahun dah usianya.


Pasangan ini juga datang menziarahi beliau. Kebetulan, kembar Aysyah dan Ayyash tidak sihat dan dimasukkan ke PHKL. Saya tidak sempat berjumpa mereka, semoga ada rezeki berjumpa di masa hadapan. 


Yang ini pun rajin memasakkan makaroni bakar dan sanggup hantarkan makanan tu malam-malam. Tak pasti pula sama ada kembar Mouaz dan Mouiz ikut sekali. Kalau saya tahu, malam tu juga saya datang 'buat-buat melawat'. 

Semoga persahabatan mereka kekal selamanya.


Sekian.
Al-ham-du-lil-lah.
All praise is due to Allah.