Saya masih memilih untuk menulis di alam siber secara percuma walaupun sesekali ada yang mencadangkan agar saya menulis buku mengenai infertiliti. Sebelum mencedok atau memetik 'ilmu' dari laman ini, anda tidak perlu meminta kebenaran tetapi diingatkan membuat semakan sendiri terlebih dahulu dengan doktor anda atau guru anda sebelum mem'forward'nya kepada orang lain dan memikul tanggungjawab akibatnya. Pohon doa kesejahteraan dan limpahan rahmat Allah ke atas guru-guru saya dan juga pesakit-pesakit saya yang banyak mengajar saya bidang ini. (peringatan untuk diri sendiri) Segala pujian bagi Allah. Mudah-mudahan, taubat saya diterimaNya dan segala dosa saya diampunkanNya serta saya terus dilimpahi rahmatNya. Sekiranya ada kesalahan, pohon dibetulkan, saya terbuka kepada teguran.

Sebarang percubaan berbentuk komen atau soalan bertujuan mengiklankan apa sahaja perniagaan atau blog sendiri tidak akan disiarkan. Blog ini bukanlah untuk iklan menjual barang. Peace.....

Sunday, 3 July 2016

Ucapan Selamat

Bis-mil-laa-hir-rah-maa-nir-ra-hiiiim.
in the name of Allah, Most Compassionate, Most Merciful.


ATCGGCGCGCATTAGCTAGCGCGCATGC
GCGCTAATATTAATSELAMATGCTAGCTA
CGCGCGGCTAGCHARICGCGTAGCATGC
TAGCCGGCCRAYAGGCATGCATGCATGC
GCTAGCCGCAIDILGCFITRIGTAGCTAAT
TACGMAAFCGATZAHIRTACGBATINATGC
GCTATACGCGGCTACGATCGGCTAGCTA


Ini code gene baru saya tahun ini.
Boleh baca 'secret message' di dalam susunan AT dan CG di atas?

.
.
.


ATCGGCGCGCATTAGCTAGCGCGCATGC
GCBERHATITAHATIATDITAATJALANRAYAGCTCTA
ATCGCGTACGGCTAGCCGATCGTAGCATGC
TAGCMARAHCGGCITUCGATMUDAHGCATGCATGC
GCTAGCCGCGCGTAGCTAATGCTACGAT
TACGSABARATTAITUCGATINDAHGC
GCTATACGCGGCTACGATCGGCTAGCTA



...serta ucapan khas untuk seseorang yang berkampung di hospital ini, bersama-sama janin-janinnya yang di dalam uterus, juga embrio-embrio yang masih dibeku-simpan di hospital ini juga. Ini kali ketiga beliau hamil. Kali pertama, beliau keguguran pada usia kandungan 5 bulan,  kandungan kembar. Kali kedua, pun keguguran pada usia kandungan 16 minggu, singleton. kedua-dua kandunga ndipasang 'cervical cerclage'. Saya lakukan ujian-ujian untuk 'recurrent miscariages' (walaupun baru 2 kali keguguran), kesemuanya normal.

Lama beliau menyepikan diri mencari kekuatan sebelum menjalani FET pada 24.05.2016 baru-baru ini.

Kali ini, beliau memilih untuk 'bermukim' di hospital ini berselang bulan (mengikut jadual suaminya yang bertugas di perantauan berselang sebulan). Beliau ada mengalami pendarahan 2 minggu yang lepas dan saya tambah ubat 'luteal support' beliau. Pendarahannya telah berhenti tetapi kawasan 'darah beku' masih sama ukurannya. Kita doakan semoga kali ini kandungan ketiga (kembar) beliau selamat dilahirkan dan mencecah usia sekurang-kurangnya 34 minggu, aamiiiiin.


Tiada ibu mahupun ayah yang sanggup menghadapi 'anak-anaknya pergi' lebih dahulu daripada mereka. Di sebelah kiri gambar adalah kubur Aisyah dan Amirah manakala di sebelah kanan adalah kubur Aydan Luqman. Semoga pasangan ini diberi kekuatan dan dibalas dengan rahmat berterusan dariNya.


Di wad, rupa-rupanya ramai rakan-rakan TTC datang memberikan sokongan moral (dan juga bekalan makanan, amboi! Bertuahnay badan!).


Ada yang sempat singgah di klinik berjumpa saya. Ini Ammar, baru berjumpa Khamis yang lepas. Dah nak masuk 3 tahun dah usianya.


Pasangan ini juga datang menziarahi beliau. Kebetulan, kembar Aysyah dan Ayyash tidak sihat dan dimasukkan ke PHKL. Saya tidak sempat berjumpa mereka, semoga ada rezeki berjumpa di masa hadapan. 


Yang ini pun rajin memasakkan makaroni bakar dan sanggup hantarkan makanan tu malam-malam. Tak pasti pula sama ada kembar Mouaz dan Mouiz ikut sekali. Kalau saya tahu, malam tu juga saya datang 'buat-buat melawat'. 

Semoga persahabatan mereka kekal selamanya.


Sekian.
Al-ham-du-lil-lah.
All praise is due to Allah.

No comments:

Post a Comment