Saya masih memilih untuk menulis di alam siber secara percuma walaupun sesekali ada yang mencadangkan agar saya menulis buku mengenai infertiliti. Sebelum mencedok atau memetik 'ilmu' dari laman ini, anda tidak perlu meminta kebenaran tetapi diingatkan membuat semakan sendiri terlebih dahulu dengan doktor anda atau guru anda sebelum mem'forward'nya kepada orang lain dan memikul tanggungjawab akibatnya. Pohon doa kesejahteraan dan limpahan rahmat Allah ke atas guru-guru saya dan juga pesakit-pesakit saya yang banyak mengajar saya bidang ini. (peringatan untuk diri sendiri) Segala pujian bagi Allah. Sekiranya ada kesalahan, pohon dibetulkan, saya terbuka kepada teguran.

Sebarang percubaan berbentuk komen atau soalan bertujuan mengiklankan apa sahaja perniagaan atau blog sendiri tidak akan disiarkan. Blog ini bukanlah untuk iklan menjual barang. Peace.....

Monday, 25 July 2016

World Embryologists Day 25th July

Bis-mil-laa-hir-rah-maa-nir-ra-hiiiiim.
In the name of Allah, Most Compassionate, Most Merciful.



Embriologis-embriologis kesayangan PHKL. 

Hanya yang tengah (Mr Tham) sahaja yang belum berpunya. Cik Chew Fang (di kiri gambar) masih single tapi setakat ini 'unavailable'. Puan Fariza (kanan gambar) pula ibu kepada 2 anak.

.
.
.

25hb Julai adalah Hari Embriologis Sedunia (World Embryologists Day).

Ia mengambil sempena tarikh lahir bayi pertama hasil persenyawaan tabung uji iaitu Louis Brown yang dilahirkan pada tahun 1978.


Embriologis sangat mempengaruhi peluang kejayaan IVF terutamanya ICSI :

- Kesabaran mencari sperma yang bagus untuk digunakan dalam ICSI.

- Teknik suntikan ICSI (boleh dilihat pada rekod 'ICSI fertilization rate' masing-masing embriologis yang sepatutnya melebihi 70%).

- Ketelitian dalam setiap langkah ICSI, penjagaan ovum, sperma mahupun embrio; kesemuanya dilakukan tanpa mengambil 'short-cut' dan sentiasa disemak/disaksikan oleh embriologis kedua.

.... banyak lagi.

.
.
.

Cuma, mereka bekerja di belakang tabir, maka kadang-kala malah mungkin lebih daripada itu i.e. selalu dilupakan.

Apabila ICSI fertilization rate bagus, doktor yang terlupa mengucapkan 'syabas' kepada mereka.

Apabila pesakit hamil, pun ada doktor yang terlupa menghargai mereka.

Apabila pesakit tidak hamil, ada pula doktor yang cepat menyalahkan embriologis tanpa menyedari bahawa mungkin kekurangan ada di pihak empunya diri sendiri ...... atau mungkin tiada kaitan langsung.

Kasihan embriolgis-embriologis ini.

.
.
.

Peringatan untuk diri sendiri.

Kita berada di sini hanya untuk membantu.

Rezeki hamil atau tiada rezeki hamil bukanlah kuasa kita.

Di samping itu, lakukan semakan semula, teliti; jika ada;  apa kesilapan serta kekurangan dan cuba baiki.

Apabila pesakit tidak hamil, janganlah cepat melatah disalahkan embriologis pula tanpa menyemak terlabih dahulu.

Entah-entah rekod kehamilan pesakit-pesakit mereka rupa-rupanya bagus dengan doktor lain.


Kepada Chew Fang, Fariza, Tham dan seluruh embriologis di mana sahaja;

Happy Embryologists Day!


Sekian.

Al-ham-du-lil-lah.
All praise is due to Allah.








Monday, 11 July 2016

Celebrating the MIRACLE BABIES of PHKL - Saturday 30th July 2016

Bis-mil-laa-hir-rah-maa-nir-ra-hiiiim.
in the name of Allah, Most Compassionate, Most Merciful.






Untuk julung-julung kalinya,
PHKL akan mengadakan pertemuan sesama pasangan yang pernah mendapatkan rawatan kesuburan di sini, sama ada :

- yang telah bersalin
- yang sedang hamil
- yang sedang dalam rawatan kehamilan
- yang pernah gagal dan masih ingin meneruskan rawatan kesuburan di PHKL

... sama ada melalui kaedah IVF, IUI atau 'courier/transporter FET'.


Cuma....

Yang tak sempat dijemput adalah yang hamil secara ubat subur sahaja atau hamil selepas menjalani pembedahan membaiki sistem peranakan eg pembedahan Endometriosis dsb kerana kami kesuntukan masa mencari rekod/fail memandangkan mereka tiada dalam rekod Unit IVF. Maka, sesiapa yang namanya tertinggal, sesiapa sahaja yang pernah mendapatkan rawatan kesuburan di PHKL dengan mana-mana doktor PHKL, bolehlah menghubungi :

03-22960892 (Ida)

... dengan memberikan nama penuh dan nombor IC atau nombor pendaftaran PHKL untuk dibuat semakan rekod/fail. Kita gunakan juga kaedah 'menjemput diri sendiri' ya. 


.
.
.

Program ini berlangsung selama setengah hari, bermula pada pukul 9.30am dan dijangka berakhir pada pukul 1 tengahari, insya' Allah.


Antara acara menarik;

1. Best Captured Moments Photo Contest.
Pastikan anda menghantar gambar tersebut menggunakan instagram seperti tertera di atas.


2. Mini Me contest
Lebih kurang ala 'siapa yang paling serupa' ala-ala My-Clone masing-masing, cuma ini lebih pada gaya pakaian. Maklumlah anak-anak kecil masih belum nampak sangat seiras rupa dengan ibu atau ayahnya. 

Ada pemerhati pada hari tersebut untuk 'memilih' pasangan ibu-anak atau ayah-anak atau ibu-ayah-anak sedondon sama ada berbaju Hari Raya ataupun berpakaian stail tersendiri.


3. Embrologist For a Day
Anda boleh menyaksikan bagaimana embriologis kami bekerja. Contohnya anda boleh melihat dengan sendiri menggunakan mikroskop yang disediakan saiz dan rupa sebenar sperma dan telur (cuma kali ini menggunakan sperma dan telur haiwan).

Malah, anda juga boleh mencuba melakukan prosedur 'sperm catching', satu prosedur yang memerlukan kemahiran embriologis dan menentukan kejayaan fertilization telur secara ICSI. Barulah anda faham akan kesukaran mereka melakukan tugasan ini, salah satu sebab mengapa kos IVF mahal. Ini baru 'sperm catching' , belum lagi prosedur lain. Sebenarnya ada banyak lagi faktor lain eg 'sperm selection' dll. 


4. Bento Set Demonstration
Anak memilih atau cerewet untuk makan? Anda boleh gunakan teknik 'menghias' makanan untuk nampak menarik di mata anak anda. Yang melakukan demonstrasi ini bukan calang-calang orang. Siapa lagi kalau bukan Pakar Pemakanan PHKL (Dietician). Sesiapa ang telah pernah mendapatan panduan pemakanan dari dietician PHKL lazimnya berpuashati dengan nasihat pengambilan kalori pemakanan yang diberikan.

Anda juga dapat membawa pulang bekas comel untuk membuat bento telur rebus.
Ini adalah di antara cenderahati yang disediakan pada hari tersebut.


6. Baby Massage Demonstration
Ini pun diajar oleh staf PHKL yang memang terlatih dalam bidang ini. Sesiapa yang pernah melahirkan bayi di PHKL mungkin pernah bertemu beliau.


7. Program-program lain seperti yang tertera di poster di atas dan beberapa pertandingan atau permainan, saya teka mungkin 'pertandingan ayah yang paling cepat memakaikan lampin anaknya'. Mungkin.


8. Program tambahan yang saya tunggu-tunggu (dah bertahun dah ni dirancang dan ditapis berkali-kali) : pelancaran website baru kami "Journey to Conception" IVF Microsite oleh CEO PHKL : En Anwar Anis.


9. "Couple's Sharing Session" secara informal.
Masa inilah nak buat support group baru atau buka WhatsApp TTC Group tambahan. 


10. Makan-makan juga ada disediakan.
Sewaktu pendaftaran 9.30-10am : light refreshment
Akhir program 12 tengahari : lunch



PROGRAM INI MELIBATKAN PIHAK MEDIA.
Ada sesi 'press conference' di antara pihak PHKL dan media.
Bagi mereka yang inginkan 'privacy' maka tidak dapat hadir, jangan bimbang, kami tidak berkecil hati. Kalau nak datang pakai topeng muka dll, kami tetap sambut dengan tangan terbuka. Tetapi bawa kad pengenalan diri ya.


Di tengah-tengah keseronokan tu, jaga anak masing-masing ya. Nak perhatikan anak orang lain pun boleh juga, manalah tahu kot-kot nak cari calon menantu, ahaha.


Tak sabar tak berjumpa setelah lama dilepaskan kepada doktor-doktor perbidanan yang lain.
Kita jumpa di sana! Insya'Allah





Sekian
Al-ham-du-lil-lah.
All praise is due to Allah.

Sunday, 3 July 2016

Ucapan Selamat

Bis-mil-laa-hir-rah-maa-nir-ra-hiiiim.
in the name of Allah, Most Compassionate, Most Merciful.


ATCGGCGCGCATTAGCTAGCGCGCATGC
GCGCTAATATTAATSELAMATGCTAGCTA
CGCGCGGCTAGCHARICGCGTAGCATGC
TAGCCGGCCRAYAGGCATGCATGCATGC
GCTAGCCGCAIDILGCFITRIGTAGCTAAT
TACGMAAFCGATZAHIRTACGBATINATGC
GCTATACGCGGCTACGATCGGCTAGCTA


Ini code gene baru saya tahun ini.
Boleh baca 'secret message' di dalam susunan AT dan CG di atas?

.
.
.


ATCGGCGCGCATTAGCTAGCGCGCATGC
GCBERHATITAHATIATDITAATJALANRAYAGCTCTA
ATCGCGTACGGCTAGCCGATCGTAGCATGC
TAGCMARAHCGGCITUCGATMUDAHGCATGCATGC
GCTAGCCGCGCGTAGCTAATGCTACGAT
TACGSABARATTAITUCGATINDAHGC
GCTATACGCGGCTACGATCGGCTAGCTA



...serta ucapan khas untuk seseorang yang berkampung di hospital ini, bersama-sama janin-janinnya yang di dalam uterus, juga embrio-embrio yang masih dibeku-simpan di hospital ini juga. Ini kali ketiga beliau hamil. Kali pertama, beliau keguguran pada usia kandungan 5 bulan,  kandungan kembar. Kali kedua, pun keguguran pada usia kandungan 16 minggu, singleton. kedua-dua kandunga ndipasang 'cervical cerclage'. Saya lakukan ujian-ujian untuk 'recurrent miscariages' (walaupun baru 2 kali keguguran), kesemuanya normal.

Lama beliau menyepikan diri mencari kekuatan sebelum menjalani FET pada 24.05.2016 baru-baru ini.

Kali ini, beliau memilih untuk 'bermukim' di hospital ini berselang bulan (mengikut jadual suaminya yang bertugas di perantauan berselang sebulan). Beliau ada mengalami pendarahan 2 minggu yang lepas dan saya tambah ubat 'luteal support' beliau. Pendarahannya telah berhenti tetapi kawasan 'darah beku' masih sama ukurannya. Kita doakan semoga kali ini kandungan ketiga (kembar) beliau selamat dilahirkan dan mencecah usia sekurang-kurangnya 34 minggu, aamiiiiin.


Tiada ibu mahupun ayah yang sanggup menghadapi 'anak-anaknya pergi' lebih dahulu daripada mereka. Di sebelah kiri gambar adalah kubur Aisyah dan Amirah manakala di sebelah kanan adalah kubur Aydan Luqman. Semoga pasangan ini diberi kekuatan dan dibalas dengan rahmat berterusan dariNya.


Di wad, rupa-rupanya ramai rakan-rakan TTC datang memberikan sokongan moral (dan juga bekalan makanan, amboi! Bertuahnay badan!).


Ada yang sempat singgah di klinik berjumpa saya. Ini Ammar, baru berjumpa Khamis yang lepas. Dah nak masuk 3 tahun dah usianya.


Pasangan ini juga datang menziarahi beliau. Kebetulan, kembar Aysyah dan Ayyash tidak sihat dan dimasukkan ke PHKL. Saya tidak sempat berjumpa mereka, semoga ada rezeki berjumpa di masa hadapan. 


Yang ini pun rajin memasakkan makaroni bakar dan sanggup hantarkan makanan tu malam-malam. Tak pasti pula sama ada kembar Mouaz dan Mouiz ikut sekali. Kalau saya tahu, malam tu juga saya datang 'buat-buat melawat'. 

Semoga persahabatan mereka kekal selamanya.


Sekian.
Al-ham-du-lil-lah.
All praise is due to Allah.

Thursday, 30 June 2016

Back to School(book)

Bis-mil-laa-hir-rah-maa-nir-ra-hiiiiim.
In the name of Allah, Most Compassionate, Most Merciful.


Hati merasa sangat teruja semula.
Saya dapat buku baru!!!!


Sewaktu 'clinical attachment' terbaru saya pada bulan Mac yang lalu, saya ada meminta panduan dari Cikgu IVF saya;

"Dr Fisher, bolehkah anda cadangkan buku teks rujukan yang bagus untuk Gynae-Endocrinology ?" (setelah dialih bahasa).

Beliau pun memberitahu akan 2 buku berkenaan dan ....

"Nanti, bila kita balik ke bilik saya, saya akan tunjukkan anda buku-buku tersebut" (juga dialih bahasa).

Selepas habis kes OPU, kami pun kembali ke bilik beliau. Cikgu IVF saya pun menunjukkan 2 buku tersebut.

Beliau menyambung lagi;

"Anda patut baca buku yang ini dahulu (sambil menunjuk kepada buku pertama) kerana ianya lebih asas dan lebih mudah difahami. Inilah 'bible' bagi Gynae-Endocrinology. Setelah anda habis membaca buku ini, barulah anda membaca buku yang lagi satu ini pula."

.
.
.

Saya cuba mencari di kedai buku-buku perubatan tempatan, tetapi jawapan yang diberikan mengecewakan. Tiada stok (read : tak dijual).


Maka saya pun gunakan pilihan lain, beli terus dari penerbitnya di USA.


Semalam, bungkusan pos yang saya tunggu-tunggu tiba akhirnya, selepas 10 hari order dan bayaran dibuat sebanyak lebih sedikit RM1000 termasuk kos pos. Masuk bab belajar, saya sentiasa ingat kata-kata Tun Dr Mahathir :

"Usah berkira belanja wang untuk beli buku".

Maka, inilah buku tersebut, kini ada di hadapan saya. Nampaknya kini lebih tebal daripada yang ditunjukkan kepunyaan Cikgu IVF saya. Maklumlah, dah bertambah lagi 5 edisi.

Hmmm....jika dilihat ketebalannya berbanding laptop saya di bawahnya, bilakah agaknya saya dapat habis membaca dan memahami keseluruhan buku ini?

Dengan :

-  Bilangan mukasurat sebanyak lebih 1400. What? 
- Hard cover book seberat 6.95 pound (bersamaan 3.15kg, kenalah saya membaca sambil beradab duduk dan buku diletakkan di atas meja sahaja, bukannya secara santai berbaring dan meletakkannya di riba atau dada).
- Saiz font yang kecil (macam saiz 8 je ni? Kenalah memakai cermin mata rabun dekat).

Saya kuat berazam nak habiskan membaca dan faham sebelum cuti Disember ini, insya' Allah.
Ada 5 bulan bermula Julai ini, bermakna sekitar 300 muka sebulan atau 10 mukasurat setiap hari.

.
.
.

Yang pertama saya buka adalah mukasurat terakhir.
Bila saya lihat mukasurat terakhir buku ini (sebelum apendiks);


Ada ditulis mengenai 'conversion factor' beberapa hormon penting bab ini, berserta julat normal nilai setiap hormon tersebut.


Kemudian, seperti biasa, saya akan baca dahulu 'preface' dari penulis, seorang Profesor Emeritus di USA yang sedia terkenal di peringkat antarabangsa dalam topik berkaitan hormon (Reproductive Endocrinology, Menopause,  Hormone Replacement Therapy, Contraception). Sungguh menarik tulisan 'preface' beliau apabila menceritakan niat beliau untuk sentiasa membaiki kandungan buku ini selengkap mungkin supaya pembaca (kami lah tu) dapat memberikan rawatan terbaik kepada pesakit-pesakit kami.


Ini bukan buku IVF.
Ini adalah buku pengetahuan mendalam mengenai topik Sakitpuan dan hormon-hormonnya.


Saya mesti baca dan faham betul-betul kandungan buku ini.
...dan saya dah boleh mula hafal kesemua 'conversion factors' pada mukasurat terakhir itu dari sekarang.


Now, I am 'occupied'.
(Ingat tak iklan 2 kanak-kanak belajar berbahasa Inggeris menyebut 'oc-cu-pie-eid' dahulu?)


Al-ham-du-lil-lah.
All praise is due to Allah.

Tuesday, 28 June 2016

Unicornuate Uterus : Hamil selepas IUI kali kedua

Bis-mil-laa-hir-rah-maa-nir-ra-hiiim.
In the name of Allah, Most Compassionate, Most Merciful.


Tanaman   Hidupan di halaman rumah dah semakin 'taman rimba natural'. Yang tak dijemput pun dah tumbuh melata.

Bulan puasa ini, saya hanya bekerja Isnin dan Khamis sahaja. Selebihnya diluangkan di rumah. Spring cleaning setahun sekali secara menyeluruh. Memilih pakaian, buku serta barang apa yang tidak diperlukan lagi. Sebenarnya bukanlah mengemas sangat pun, kebanyakannya setakat 'memindahkan' dari satu lokasi ke lokasi yang lain di dalam rumah ini, dengan alasan 'sayang nak buang'. Hoarder betul Mokcik seorang ni.

.
.
.

Asyik menulis mengenai IVF sahaja.
Kali ini saya tulis mengenai satu keadaan keabnormalan rahim (uterus) yang dinamakan 'Unicornuate Uterus'. Unicornuate Uterus adalah satu penyakit kongenital yang menyebabkan kelainan pada pembentukan rahim dan Unicornuate Uterus berlaku dalam peratus yang rendah berbanding kelainan rahim yang lain (eg septate uterus, bicornuate uterus).

Kita ikuti dahulu kisah pesakit ini.

.
.
.

Profil pesakit

Usia 35 tahun.
Berkahwin awal 2015.
Sebelum berjumpa saya, beliau diberitahu mengalami fibroid (kecil saiznya) sewaktu menjalani pemeriksaan doktor.

Pertama kali berjumpa saya pada Ogos 2015 untuk mendapatkan rawatan kesuburan.
Kitaran haidnya teratur (maka, besar kemungkinan ovulasi beliau pun teratur).

Scan : rahim saiznya kecil berbanding saiz rahim wanita dewasa dan puncaknya pula condong ke kiri. Kelihatan ketulan kecil di bahagian kanan uterusnya. Pada waktu ini, saya masih belum membuat diagnosis 'unicornuate uterus' kerana menyangka saiz rahimnya ada kaitan dengan produk kesihatan yang beliau amalkan (pernah berlaku kes-kes sedemikian sebelum itu). Kebetulan beliau didapati subur dari ovari sebelah kanan.

Rupa-rupanya ujian HSG mendapati beliau mempunyai 'left unicornuate uterus'. Mujurlah tiub falopian kiri tidak tersumbat. 


Gambar HSG di atas tidak jelas kerana ruang rahim yang 'lonjong' ini turut dibayangi oleh cecair 'contrast' yang telah keluar dari hujung tiub falopian dan mengisi ruang pelvis di latar belakang rahim. Sebagai perbandingan, gamabr HSG kecil di sebelah kanan pula menunjukkan ruang rahim yang normal i.e. berbentuk segitiga terbalik.

.
.
.

Apakah itu Unicornuate Uterus? Bagaimanakah ia terjadi?

Kita mestilah faham bab teori pembentukan Sistem Mullerian yang berlaku sewaktu kita di dalam rahim ibu dahulu, bermula pada usia kandungan 8 minggu dan lengkap apabila memasuki sekitar 5 bulan (21 minggu). Anda boleh baca bahan rujukan bab PEMBENTUKAN SISTEM MULLERIAN sama ada dalam bahan/buku Embryology ataupun buku/bahan Obstetrics and Gynaecology. 

Hanya setelah kita faham mengenai proses pembentukan Sistem Mullerian ini (yang membentuk rahim, kedua tiub falopian dan 1/3 faraj bahagian atas, barulah kita faham mengenai mengapakah boleh terbentuk unicornuate uterus serta penyakit kongenital rahim (dan tiub falopian serta 1/3 faraj bahagian atas) yang lain seperti :

- tiada perkembangan langsung/ atau hanya sedikit sahaja (agenesis/hypoplasia) seperti tiada lubang faraj, septum faraj, tiada rahim, tiada lubang pintu rahim, tiada tiub falopian, atau apa-apa kombinasi mereka. Pernah dengar Sindrom MRKH (bukan jenama beg tangan tetapi Mayer-Rokitansky-Kuster-Hauser)? 

- unicornuate (pun ada jenis-jenisnya eg communicating, non-communicating, no cavity, no horn)

- rahim kembar (didelphys)

- rahim bertanduk (bicornuate)

- rahim berdinding/septum (septate uterus)

- rahim berlekuk (arcuate uterus)

- ruang rahim yang tirus, benbentuk T dll (yang ini disebabkan oleh pengambilan bahan DES oleh ibu hamil) 

.
.
.

Apakah maknanya mempunyai unicornuate uterus bagi beliau?

1. Mempunyai unicornuate uterus bermakna beliau mempunyai keabnormalan bentuk ruang rahim (ruang mengandung). Ruang yang sepatutnya berbentuk segitiga kini hanyalah berbentuk seperti tiub panjang dan kecil dan ini boleh mengganggu kekuatannya untuk menampung kehamilan. Ia juga ditambah faktor kekurangan otot dinding rahim yang sepatutnya mengembang sewaktu hamil untuk menampung kandungan yang semakin membesar. Ini meningkatkan risiko seperti keguguran sama ada trimester pertama mahupun kedua, kelahiran pramatang, keabnormalan posisi janin (songsang), placenta previa, pembedahan Caesarean, IUGR dll.

.

2. Sebab itulah scan mendapati rahimnya kecil. Sukar untuk membuat diagnosis unicornuate uterus dengan imbasan scan 2D sekali pintas kerana ciri-ciri seperti saiz rahim yang kecil, keadaan endometrium yang dilihat sehingga ke kawasan berhampiran pangkal tiub kadangkala tidak diambil perhatian. Maka ketulan yang besar kemungkinannya adalah bahagian rahim sebelah 'kanan' yang tidak mengembang itu disangka fibroid, sedangkan ia mungkin sebenarnya 'right uterine tubercle/horn' yang terbantut perkembangannya. Saya tidak mempunyai 3D vaginal probe, maka saya tidak dapat membuat penilaian yang lebih mendalam menggunakan TVS. Alternatif lain adalah menjalani MRI atau pembedahan laparoskopi, tetapi kosnya sangat mahal berbanding scan. Beliau memilih untuk tidak menjalani kedua-dua kaedah tersebut.

Oleh kerana beliau tidak mempunyai simptom seperti senggugut (boleh disebabkan oleh kehadiran tisu endometrium di dalam 'rahim kanan' sekiranya beliau mempunyai 'unicornuate uterus jenis non-communicating') dan scan pula tidak menampakkan endometrium pada ketulan/horn tersebut, maka saya tidak mencadangkan pembedahan laparoskopi untuk beliau. Pada telahan saya, besar kemungkinan unicornuate uterus beliau adalah sama ada jenis :
- 'no cavity' atau sebenarnya
- 'no horn' pun kerana ketulan itu sebenarnya adalah fibroid.

Jika ada tisu endometrium dikesan pada 'rahim kanan', maka unicornuate uterus itu adalah sama ada jenis communicating atau non-communicating. Jika benar, beliau perlu menjalani pembedahan untuk membuang 'rahim kanan'nya bagi mengelakkan komplikasi seperti endometriosis (lebih kerap) dan kehamilan ektopik (jarang tetapi masih boleh berlaku).

.

3. Memandangkan tiub falopian kanannya tidak berfungsi, maka ovulasi dari ovari kanan kebiasaannya tidak membuahkan kehamilan kerana ovum dari ovari kanan tidak dapat memasuki tiub falopian kanan yang tersumbat pangkalnya (lihat HSG di atas). Dalam ayat ini, saya katakan 'kebiasaannya' kerana secara teori (dan pernah berlaku tetapi sangat jarang), ovum kanan masih boleh 'ditarik' masuk ke dalam tiub falopian kiri di seberangnya dan membuahkan kehamilan. Maka, bolehlah dianggap bahawa beliau hanya berpeluang hamil secara spontan mahupun IUI hanya sekiranya ada ovulasi dari ovari kiri.

(Secara teori, masih ada kemungkinan beliau hamil dari ovum sebelah ovari kanan yang memasuki tiub kiri dan hamil sama ada di dalam rahim ataupun ektopik di dalam tiub kanan. Begitu juga, secara teori, ada kemungkinan beliau hamil dari ovum sebelah ovari kanan yang memasuki tiub kiri dan menyebabkan kehamilan ektopik di dalam tiub kiri. Dalam dunia perubatan, segalanya berkemungkinan walaupun dalam peratus yang sangat rendah).

.

4. Kita tahu, memandangkan tiada giliran dari ovari manakah ovulasi akan berlaku pada wanita (ie bukannya berselang bulan ini dari ovari kanan dan bulan hadapan pula dari ovari kiri dan seterusnya bergilir-gilir. Ini salah), maka saya galakkan beliau mengambil ubat kesuburan. Tujuan saya adalah untuk bagi menambah bilangan folikel telur matang supaya ada sahaja folikel telur matang dari ovari kiri selain dari ovari kanan.

Dalam erti kata lain, pengambilan ubat kesuburan yang sesuai dapat memastikan ada sahaja folikel telur matang dari ovari kiri pada setiap bulan/kitaran. Jika tidak, contohnya, jika ditakdirkan beliau hanya ovulasi dari ovari sebelah kanan sahaja berturut-turut setiap bulan, maka hampir tiadalah peluang beliau untuk hamil kerana tiub falopian kanan tidak sempurna pembentukannya serta tidak berfungsi.

.


5. 'Unicornuate uterus' adalah satu kelainan pembentukan 'sistem  duktus Mullerian' yang sepatutnya bertanggungjawab berkembang membentuk 1 rahim yang sempurna, 1 pintu rahim (serviks) yang sempurna, 2 tiub falopian yang sempurna, sebahagian laluan faraj yang sempurna.

Sistem Mullerian (nama lainnya para-mesonephric duct) juga ada kaitan dengan Sistem Wolffian (nama lainnya mesonephric duct) pada awal pembentukan janin. Kita tahu secara teori bahawa duktus mesonephric terlibat dengan pembentukan sistem buah pinggang dan salur ureter. Maka, wanita yang mempunyai penyakit kelainan Mullerian seperti beliau perlu menjalani ujian pengesahan ini.

Saya perlu tahu keadaan buah pinggang dan ureter beliau.


Apakah langkah seterusnya?

Mujurlah, beliau mempunyai buah pinggang dan ureter yang normal pada kanan dan kirinya.

(40% wanita unicornuate uterus dilaporkan mempunyai kelainan pada buah pinggang dan ureter. Ada  yang mempunyai 1 sahaja buah pinggang, pelvic kidney, horse-shoe kidney, ada pula yang mempunyai 2 ureter pada sebelah bahagian dsb).


.
.
.

Saya berikan pil kesuburan dengan tujuan untuk memastikan beliau ada folikel telur yang matang di dalam ovari kirinya (kan kita nak guna ovari kiri sahaja kerana tiub falopian kiri sahaja yang berfungsi).


Percubaan pertama rawatan kesuburan (Disember 2015).
Dengan pil Clomiphene citrate sebanyak 100mg selama 5 hari, hanya ada 1 sahaja folikel telur yang matang dari ovari kiri. Endometrium bagus ketebalannya. Sperma suami juga bagus. Beliau menjalani IUI. Luteal support menggunakan pil makan progestin. Beliau tidak hamil.


Percubaan kedua rawatan kesuburan (Februari 2016)
Ubat kesuburan : pil Clomiphene citrate 100mg pun selama 5 hari dan kali ini saya tambah dengan suntikan u-FSH 150 IU sebanyak 3 kali. Tujuan saya : untuk mendapatkan sekitar 2-3 folikel telur matang dari ovari kanan, ini dapat menambah peluang kehamilan beliau. Namun kali ini, hanya ovari kanan pula yang menunjukkan respon dan mengandungi folikel telur matang manakal ovari kiri pula tiada folikel matang. Maka tidaklah dilakukan IUI (takkan nak buat IUI sedangkan saya tahu besar kemungkinan ia tidak akan berjaya). Saya tukar kepada 'timed intercourse' sahaja. Beliau tidak hamil.


Percubaan ketiga rawatan kesuburan (Mei 2016)
Saya gunakan suntikan kesuburan u-FSH dari awal dan untuk tempoh yang lebih lama, dos keseluruhan lebih banyak. Kali ini, terlebih respon pula. Hmmm.... Ada terdapat 4 folikel telur matang dari ovari kiri (2 lagi folikel matang ada di ovari kanan tetapi kita 'abaikan' sahaja). IUI dilakukan pada 12 Mei. Luteal support menggunakan vaginal progestin.


BhCG kira-kira 2 minggu selepas itu menunjukkan keputusan yang bagus.


BhCG juga didapati meningkat dengan cepatnya, lebih 2 kali ganda selepas 48 jam. Hmm...adakah beliau hamil kembar?



Scan seminggu selepas itu mendapati benar, beliau hamil kembar (terdapat 2 kantung IUGS) tetapi yang satu itu lebih kecil. Beliau kemudiannya mengalami pendarahan (keguguran dari kantung yang kecil) yang berhenti setelah diberi ubat progestin tambahan.



Semalam, beliau datang menjalani pemeriksaan. Dah 8 minggu kandungannya. Kandungan lagi satu dah semakin mengecil. Pendarahan beliau juga telah lama berhenti, tetapi saya sambung juga kedua-dua ubat progestin beliau.


videoKlip vi
Klip video scan menggunakan doppler, nampak aliran darah di dalam janin ini. 

Pintu rahim beliau juga masih bagus ukuran panjangnya. Saya perlu ukur panjanng serviks beliau secara regular.

Saya jadualkan beliau datang semula selepas 3 minggu, lebih kerap berbanding wanita hamil yang lain (setiap 4 minggu).


Kini beliau telah hamil, beliau memerlukan pemantauan ke atas risiko-risiko yang dinyatakan dalam point (1) di atas. Beliau mungkin memerlukan prosedur 'cervical cerclage', penggunaan ubat anti-kontraksi rahim, pembedahan Caesarean dll. Mungkin. Risiko keguguran beliau pula dijangka meningkat 3 kali ganda berbanding wanita lain, disebabkan oleh kelainan pada bentuk fizikal dan struktur otot rahim. Kajian melaporkan 1 : 4 wanita unicornuate uterus mengalami risiko keguguran. 25% adalah angka yang tinggi. Saya juga perlu peka kepada risiko IUGR, maka perkembangan/tumbesaran janin beliau saya perlu rekod ukurannya pada carta dengan berkala, begitu juga dengan keadaan air ketubannya.


Beliau perlu difahamkan akan perkara ini.

.
.
.


Dua lagi contoh unicornuate uterus. Nampak kan bentuk ruang rahim yang lonjong seperti tiub? Secara kebetulan, kedua-dua kes ini juga jenis 'left unicornuate uterus'. Apakah 'left' lebih kerap daripada 'right' unicornuate uterus?

.
.
.


Adakah anda juga mempunyai kelainan Mullerian? Bagaimanakah anda ingin mengetahuinya?

Sekiranya anda mengalami senggugut dari awal baligh lagi, eloklah anda menjalani pemeriksaan doktor untuk kepastian. Ini mungkin petanda unicornuate uterus jenis non-communicating.


Sebagai doktor pula, saya perlu meningkatkan lagi kepekaan saya dalam membuat diagnosis kelainan Mullerian dll menggunakan alat ultrasound scan. Kelainan Mullerian tidak dapat dikesan dari pemeriksaan fizikal kerana ciri-ciri fizikal luaran adalah wanita. 

Menggunakan ultrasound scan ini memerlukan pengetahuan dan pengalaman. Ini 2 perkara yang sangat penting. Ia sama seperti mencari gambar tersembunyi. Sekiranya saya tak tahu apa yang saya nak cari, saya tak akan cari benda itu. Sekiranya saya tidak cukup ilmu pengetahuan ultrasound, saya akan cari apa yang saya nak lihat sahaja dan 'membutakan' penglihatan saya daripada benda lain walaupun ia ada terpampang di hadapan mata saya. 

Pengetahuan itu penting.

Cara pemeriksaan scan juga penting. Tiada short-cut. Kena buat satu persatu. Contohnya jika nak lihat rahim (uterus), perlu lihat secara 2-section : sagittal (menegak dari sisi) dan coronal (melintang). Kemudian kena susur dari pangkal/serviks ke puncak rahim, seterusnya susur pula dari kiri ke kanan.  Lihat setiap lapisan. Bagi endometrium pula, susur sehingga ke kawasan rahim memasuki pangkal tiub falopian. Barulah dapat melihat keseluruhan rahim. Itu baru rahim. Jika ada 3D probe lagi bagus tetapi ia tidak didatangkan dalam kebanyakan set mesin ultrasound yang dijual di Malaysia. Apa pu, secanggih manapun alat, jika kita doktor kurang pengetahuan dan pegalaman, kita tidak akan 'mengenalpasti' apa imej yang ada diperlihatkan di monitor itu.




Sekian.
Al-ham-du-lil-lah.
All praise is due to Allah.

Monday, 20 June 2016

Another Successful IVF Story

Bis-mil-laa-hir-rah-maa-nir-ra-hiiim.
In the name of Allah, Most Compassionate, Most Merciful.





Ibu bayi baru sahaja bersalin minggu lepas. Bayi ini dilahirkan pada usia kandungan 38 minggu, seberat 2.8kg. Bertambah berseri  pengantin perempuan ini  bayi ini dengan warna hijau tu.

Saya belum pernah bercerita mengenai ibu beliau sebelum ini.


Terima kasih kerana sudi berkongsi kisah di sini, untuk panduan umum.
Kisah rawatannya berlainan dengan kebanyakan pesakit IVF saya.

Usia : 34 tahun (masih muda)
Berkahwin : April 2012

IVF kali pertama June 2015 : 
Protokol dirancang : Stimulation-Antagonist protocol-agonist triggering-OPU-ICSI-blastocyst culture-ET.
Tetapi apa yang berlaku, tiada ET dilakukan. Ini kerana, pada hari OPU (29.06.2015), didapati beliau mengalami ovulasi awal. 
Maka hanya 3 sahaja telur yang diperolehi (2MII dan 1MI)
ICSI ke atas 2 telur MII : 2 fertilized

Cuma 1 sahaja yang membahagi tetapi lambat perkembangannya (day-3 baru 2C2), 1 lagi pula tidak membahagi.
Pesakit memilih untuk freeze embrio tersebut. ET tidak dilakukan.

Mereka kemudiannya membuat keputusan untuk mencuba stimulation-OPU sekali lagi, mudah-mudahan kali ini dapat embrio yang bagus grednya. Embrio yang sedia beku itu terus disimpan.

.
.
.

IVF kali kedua pada Ogos 2015.
Kali ini, saya ubahsuai ubat-ubatan yang digunakan dalam protokol ini, dengan tujuan untuk mengelakkan ovulasi awal.
Masih Antagonist Protocol tetapi ubat antagonist dimulakan lebih awal dan ditambah.
Cuma, beliau terpaksa menjalani ujian darah /hormon secara berkala (tidak saya lakukan dalam pesakit-pesakit lain)
Masih Agonist triggering.
Dah plan awal-awal untuk freeze-all-transfer-later

OPU pada 18.08.2015 : dapat 7 telur (5MII, 1MI dan 1 lagi abnormal MII)


ICSI atas 5 MII normal : semua 5 fertlized dan dibekukan pada day-3 dalam 2 straw.


FET pada bulan berikutnya
Yang ini saya gunakan ubat endometrial priming seperti kebanyakan pesakit saya yang lain.
Embriologis thawed 1 straw yang mengandungi 2 embrio.
Kemudian dilakukan extended culture sehingga usia day-5.
FET dilakukan pada 28.09.2015

Kedua-dua embrio menjadi blastocyst : gred 3BB dan 3BC dan hatching

Luteal support : pun saya gunakan ubat seperti kebanyakan pesakit lain (sama ada gel atau kapsul progestin vaginal). Cuma, beliau mengalami kesan samping 'local', maka saya tukar kepada ubat suntikan (Ouch! Sakit ni sebab ubat ni dari minyak).

BhCG menunjukkan paras yang baik, besar kemungkinan seorang sahaja ni.

Beliau disahkan hamil secara klinikal dengan seorang janin (besar kemungkinan dari embrio 3BB).
Saya followed-up sehingga usia kandungan 12 minggu, sebelum merujuk beliau kepada Pakar Perbidanan pilihan beliau, Dato' Dr Abdul Aziz Yahya di Pusat Perubatan Prince Court (PCMC).

Jangka bersalin pada 17.06.2016 tetapi sehingga cukup bulan, kandungan masih berada dalam kedudukan 'breech'. Maka Pakar Perbidanan beliau pun melakukan pembedahan Caesarean pada 03.06.16 baru-baru ini di PCMC. 

Beliau masih ada frozen embryos :
- 1 straw mengandungi 3 embrio dari OPU kedua
- 1 straw mengandungi 1 embrio dari OPU pertama


Data dari beliau yang boleh dimasukkan ke dalam kumpulan statistik kami:
Denominator
- bilangan OPU = 2
- bilangan ET = 1

Nominator
- bilangan kehamilan = 1
- bilangan implantasi = 1/2 embrio yang dimasukkan
- bilangan delivery = 1
- bilangan live birth = 1

.
.
.

Perbincangan
Ada pesakit yang boleh mengalami ovulasi awal (sebelum jangkaan OPU), namun lazimnya bagi wanita lebih berusia sedangkan beliau masih muda lagi. Saya tidak menjangkakan dalam keadaan beliau kerana usia beliau masih muda. Malah, untuk OPU kedua, saya awalkan lagi waktu OPU beliau sebanyak tambahan 15 minit.

Yang saya pasti, bukanlah disebabkan kesilapan penjagaan suhu ubat dan teknik suntikan kerana pasangan ini memang begitu teliti. Hampir setiap arahan yang saya beritahu (dan saya tuliskan), beliau akan tulis semula dalam satu buku nota khas beliau. Suaminya juga akan menyemak dos ubat serta teknik penyediaan ubat dan beliau menyuntik isteri beliau. 

Saya juga kurang pasti mengapakah kualiti embrio pada IVF pertama kurang bagus. Adakah kerana ubat? Adakah kerana faktor dalaman? 

Apakah saya akan menggunakan pendekatan ubat tambahan ke atas pesakit lain selepas itu? Jawapan saya = tidak. Ini kerana sangat jarang ia berlaku. Malah dalam kebanyakan pesakit yang lebih berusia juga saya tidak berbuat demikian, kecuali jika saya dapati saiz folikel membesar melebihi jangkaan saya sewaktu monitoroing. 


Sekian.
Al-ham-du-lil-lah.
All praise is due to Allah.



Thursday, 16 June 2016

One Shot, Make It Count : Single Embryo Transfer lagi, FET lagi.

Bis-mil-laa-hir-rah-maa-nir-ra-hiiim,
In the name of Allah, Most Compassionate, Most Merciful.


ONE SHOT, MAKE IT COUNT.


'One shot, make it count' adalah peribahasa yang boleh digunakan dalam banyak perkara.

'One shot at life, make it count' adalah peribahasa yang bermaksud : jangan disia-siakan peluang hidup yang kita ada kerana kita hidup di dunia ini hanyalah sekali sahaja.

'One shot with that egg, make it count' dalam post ini pula adalah mengenai kisah pesakit IVF ini yang hanya mempunyai 1 sahaja telur MII sewaktu OPU. 

1 sahaja.
.
.
.

Profil beliau


- Usia 32 tahun (masih muda - besar harapan kualiti telurnya bagus, peluang IVF berjaya juga bagus).

- Berkahwin November 2010 (sepatutnya pada usia perkahwinan beliau 26 tahun, tahap kesuburan beliau optimum. Tetapi beliau masih belum hamil dalam masa setahun sedangkan peratus yang hamil dalam masa setahun adalah sekitar 85%. Mengapakah beliau masih belum hamil?).

- Berat badan beliau ideal mengikut ketinggiannya. BMI 21.8 kg/m2 (bagus)


Penyakit dikesan :

1. PCOS with anovulation dengan kitaran haid kebanyakannnya 60 hari. Lazimya kes sebegini boleh dirawat dengan ubat kesuburan, jika tidak berkesan barulah dilakukan ovarian drilling (bukan wedge biopsy kerana kajian mendapati ia menyebabkan lebih komplikasi perlekatan).

2. Penyakit tiub falopian (yang ini penting). Sewaktu pembedahan laparoskopi pada tahun 2012, didapati kedua belah tiub falopiannya tersekat-sekat alirannya. Apabila dilakukan 'dye insufflation', tiub kelihatan berbonggol-bonggol dan dye lambat keluar dari penghujung tiub serta sedikit/perlahan sahaja. Saya berpendapat tiub falopian adalah faktor utama masalah kesuburan beliau, bukannya PCOS. 


Lama beliau berehat selepas itu.
April 2015 beliau merancang nak buat IUI, maka beliau pun mengambil ubat pil dan suntikan kesuburan. Dengan bilangan folikel telur yang sesuai dan ditambah pula dengan prosedur IUI, beliau masih belum berjaya hamil. 

Kesangsian mengenai fungsi tiub falopian semakin bertambah. Lebih-lebih lagi kini didapati kedudukan ovari kiri jauh dari sepatutnya dan terhalang oleh kawasan 'vascular'. Mungkinkah telah ada perlekatan di ruang pelvis?

Beliau dinasihati menjalani IVF. Tetapi, maklum sahajalah, IVF bukannya murah.

.
.
.

April 2016
Beliau pun menjalani IVF.

Protokol yang saya rancang utuk gunakan (cuba teka, senang je sekarang) :
- Antagonist protocol with agonist triggering
- ICSI
- Freeze-all embryos using vitrification and transfer-later
- Extended embryo culture until blastocyst stage
- Endometrial priming for FET cycle
- FET (probably elective 1-embryo or 2-embryo transfer)


Saya gunakan suntikan FSH dos 150 IU setiap hari.
Ovari kanan hanya ada beberapa folikel cantik, ovari kiri sebaliknya jauh lebih banyak.

(Apa yang saya pelajari di sana dahulu, dalam keadaan ini di mana hanya ada beberapa sahaja folikel yang besar dan banyak lagi yang masih kecil, ada pilihan untuk melakukan OPU ke atas folikel besar, kemudian sambung semula suntikan rangsangan, disusuli dengan OPU kali kedua. Maknanya 2 kali OPU. Tetapi kosnya memanglah berganda. Saya belum pernah lakukan sebegini di sini. Maka saya buat sekali sahaja).


OPU pada 18.04.2016
Hanya boleh diambil dari ovari kanan sahaja. Akibat kawasan 'vascular, saya mengalami kesukaran untuk mencari kawasan selamat pada sebelah kiri, akhirnya saya memutuskan untuk 'abandon' ovari kiri.


Dapat 3 telur dari ovari kanan :
- 1 telur MII 
- 1 telur MI 
- 1 lagi pula rupa-rupanya telur kosong di mana hanya zona pellucida sahaja tetapi tiada sitoplasma/nukleus (telur paling atas dalam gambar ini).


Petang itu, embriologis pun melakukan ICSI ke atas telur MII tersebut.
Telur MI pula menjalani proses IVM (In Vitro Maturation) dengan harapan keesokannya mungkin akan jadi MII, maka bolehlah dilakukan ICSI keesokannya.


Keesokannya didapati:

- 1 telur MII tersebut berjaya fertilization (gambar sebelah kiri)
- 1 telur MI menunjukkan degradasi - maka tak dapatlah dilakukan ICSI, terpaksa dibuang

Kini beliau hanya ada 1 embrio sahaja untuk digunakan.
Satu sahaja embrio.
S.a.t.u.

.
.
.

Maka, 
Apakah kini saya perlu mengubah plan asal saya?
Adakah saya perlu memasukkan embrio dalam fresh cycle ini dan membatalkan plan untuk freeze-now-transfer-later?
Apakah peluang yang beliau ada sekiranya dimasukkan fresh ET cycle itu berbanding FET pada cycle lain kelak?


To freeze or not to freeze that single embryo?
Tiada lagi peluang 'selecting the best embryo' kerana kini yang ada hanyalah satu sahaja embrio.

.
.
.

Saya berbincang dengan pasangan mengenai pilihan yang ada serta apakah peluang bagi kedua-dua pilihan tersebut. Seperti yang telah saya tuliskan dalam post terdahulu, FET memberikan peluang yang lebih baik berbanding fresh ET. Saya beritahu mereka semula. Saya beri maklumat, merekalah yang berkuasa membuat pilihan.

Pasangan memilih FET.
Selebihnya kita berserah. 

1. Kita telah melakukan yang terbaik dan kita ikut plan terbaik berdasarkan bukti kajian yang ada serta pengalaman yang saya pernah lalui (seingat saya, sebelum ini telah ada sekurang-kurangnya 2 pesakit dengan senario yang sama : 1 telur MII : 1 embrio sahaja dan kedua-duanya telah selamat melahirkan bayi sihat).

2. Lagipun pada usia beliau, kualiti embrio lazimnya bagus, kromosomnya juga normal, maka embrio ini dijangka boleh survive proses freezing dan thawing kelak. Kita berpegang pada itu. 

3. Embriologis saya juga berpengalaman melakukan vitrification dengan cekap.

4. Makmal IVF di PHKL juga sentiasa dijaga penjagaan kualiti persekitarannya (penting untuk 'embryo culture' terutamanya 'extended culture sehingga peringkat blastocyst').

Pada pendapat saya, jika embrio itu kromosomnya normal (usia beliau masih muda, maka peluangnya lebih), embrio itu akan survive the thawing process after vitrification.
Selebihnya, kita berserah.
Mudah-mudahan berjaya.


Embrio yang satu itu pada usia day-3. Bukanlah gred yang cantik. Embriologis bagi gred 4C3. Kami teruskan juga dengan plan asal walaupun bukan lagi freeze-all-transfer-later tetapi freeze-that-only-one-transfer-later.

.
.
.

Bulan berikutnya, Mei, beliau didatangi haid pada 1hb.
Saya pun aturkan jadual beliau untuk mengambil ubat untuk endometrial priming. Setelah bersedia, saya memaklumkan kepada embriologis saya. Kami pun memilih hari yang paling sesuai untuk dilakukan thawing berdasarkan hari yang saya ingin lakukan FET dan peringkat embrio sewaktu dibekukan dahulu.

Kami rancang untuk buat FET pada 24hb. Jadual ubat ditukar sejajar mengikut hari FET (ini sangat penting). Saya ikut 'strictly' berpandukan modifikasi protokol yang saya baru pelajari sewaktu 'clinical attachment' dengan Cikgu IVF saya baru-baru ini. LPS (Luteal Phase Support) menggunakan kaedah vaginal progestin serta beberapa ubat tambahan.

.
.
.

Pada 24hb Mei, embrio telah berkembang menjadi blastocyst.

Day-6 blastocyst (ingat tak pada Day-3 sebelum freezing embrio beliau baru sahaja 4-sel?). Embriologis bagi gred : 4BB (lower) dan hatching (tak nampak dalam gamabr ini). Beliau pun menjalani FET.

Masing-masing berdebar menunggu hasil keputusan.
Pengesahan kehamilan dijadualkan 8 hari selepas FET.
Bayangkan debaran mereka menunggu selama 8 hari itu.

Secara biochemical : ujian BhCG pada 1hb Jun menunjukkan paras yang baik sebanyak 105 IU/L.


Secara clinical/scan : tengahari tadi dah nampak kantung (IUGS) dan dah nampak yolk sac di dalam IUGS tersebut.


video
Klip video hari yang sama. Bila diujin dengan kaedah doppler, telah nampak aliran darah tetapi masih belum jelas. Hari ini, kandungan beliau baru sahaja 6 minggu usianya.


Langkah seterusnya untuk beliau : Teruskan ubat vaginal progestin sehingga kandungan berusia 10-13 minggu. Saya akan periksa sekali lagi sebelum cuti hari raya.

.
.
.

Saya lega kerana pasangan ini memilih kaedah Freeze-then-transfer-later walaupun hanya ada 1 embrio sahaja. Saya sangat bersyukur kerana beliau hamil. Sememangnya bukanlah kuasa atau kepandaian kami kerana embrio beliau pada Day-3 bukanlah embrio gred cantik. Memang ada teori 'self-correction' di dalam embrio sewaktu thawing, tetapi semua kita tahu yang menetapkan sesuatu kandungan itu normal atau tidak hanyalah Dia dan disebabkan itu, kami lagi kuat berdoa kepadaNya dan berserah.

Saya sukakan amalan 'Evidence-based Medicine' lebih-lebih lagi kajian-kajian jenis large prospective RCT. Bukannya setakat gerak hati sahaja kerana bimbang jika embrio yang satu ini tidak survive selepas thawing. Bukan juga mengikut hasil kajian jenis pemerhatian sahaja ataupun kajian jenis retrospective. Namun saya terpaksa bergantung kepada kajian-kajian antarabangsa kerana bilangan cycle IVF mereka jauh lebih besar dari di negara kita, maka hasil kajian lebih dipercayai berbanding jika sampelnya kecil. 

Maka, saya kena selalu cari informasi mengenai ini, sama ada dari hasil kajian yang diterbitkan di dalam jurnal atau dibentangkan dalam persidangan perubatan dan yang saya lebih suka adalah secara 'fast track' menyerap informasi tersebut dari Cikgu IVF saya.

Beliau seperti 'walking textbook'. Saya masih ingat kali pertama berguru dengannya, pada waktu itu saya baru berusia 33 tahun, baru setahun jadi pakar pun. Beliau memberitahu mengenai paras hormon progesteron yang sesuai untuk pesakit itu. Beliau menyatakan paras hormon progesteron dalam unit ng/ml. Saya mencelah;

"Di tempat saya, kami gunakan unit nmol/L....." (setelah dialih bahasa).

Beliau pantas menjawab tanpa berfikir;

"Anda hanya perlu darabkan dengan faktor 3.18" (pun setelah dialih bahasa)

(lantas ku terpegun dengan kepandaiannya jawapannya).

.....


Itu baru satu hormon. Lain hormon lain faktor penukarannya (conversion factor) kerana lain hormon lain berat molekulnya. Maka nilai tukaran ng/ml kepada nmol/L berbeza di antara sesuatu bahan.  

Nak kena tahu berapakah berat molekul bahan tersebut yang juga bersamaan dengan jisim molar bahan dalam unit gram per mol.

Sama ada kita nak hafal (tapi kan banyak hormon lain nak kena hafal) jisim molar dan kemudiannya buat pengiraan penukaran unit mengikut formula; ataupun terus hafal 'conversion factor' bagi setiap hormon yang kita nak tahu. Haaaa? Nak kena hafal setiap satu?

Contohnya;

Jisim molar bagi progesteron adalah = 314.46 g/mol (nilai angka ini adalah fakta, nilai ini kenalah cari dalam jadual atau anda kena hafal sendiri)

Maka, nak tukar dari 1 ng/ml kepada berapa nmol/L,

1 ng/ml = 1 ng/ml x 1000ml/L x 1mol/314.46g = 3.18nmol/L

dan nak tukar 2 ng/ml = 2ng/ml x 1000 ng/L x 1mol/314.46g = 6.36 nmol/L

Tetapi kalau dah hafal 'conversion factor bagi progesteron dari ng/ml kepada nmol/L (iaitu = 3.18), maka boleh terus darabkan 2ng/ml x (3.18) = 6.36 nmol/L

Saya terus rasa malu bercampur tercabar. Saya mesti belajar lebih banyak lagi, walaupun saya sedar saya tak akan terkejar ilmu rawatan kesuburan pada beliau. Jika perkara 'remeh' macam ni pun dia boleh tahu/hafal, inikan pula perkara lain yang menjadi kemestian. 


Hmm.....asyik 'ke laut' je ni.


Mudah-mudahan pesakit ini selamat kandungannya.

Ingatan untuk diri sendiri : One shot at life. Make it count. Semoga Allah menerima taubat saya dan mengampuni semua dosa saya dan semoga saya dirahmatiNya untuk sentiasa berubah ke arah yang lebih baik lagi. (dan saya doakan semoga kita semua begitu juga)


Sekian.
Al-ham-du-lil-lah.
All praise is due to Allah.